Volume 4, Issue 4 (December 2019)                   J Environ Health Sustain Dev 2019, 4(4): 895-902 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Soleimani M, Khalili Sadrabad E, Hamidian N, Heydari A, Akrami Mohajeri F. Prevalence and Antibiotic Resistance of Listeria Monocytogenes in Chicken Meat Retailers in Yazd, Iran. J Environ Health Sustain Dev 2019; 4 (4) :895-902
URL: http://jehsd.ssu.ac.ir/article-1-216-en.html
Zoonotic Diseases Research Center, School of Public Health, Shahid Sadoughi University of Medical Sciences, Yazd, Iran.
Full-Text [PDF 551 kb]   (556 Downloads)     |   Abstract (HTML)  (1673 Views)
Full-Text:   (630 Views)
Prevalence and Antibiotic Resistance of Listeria Monocytogenes in Chicken Meat Retailers in Yazd, Iran
 
Meysam Soleimani 1, Elham Khalili Sadrabad 1, Negar Hamidian 1, Ali Heydari 1, Fateme Akrami Mohajeri 1*
 
1 Zoonotic Diseases Research Center, School of Public Health, Shahid Sadoughi University of Medical Sciences, Yazd, Iran.
 
A R T I C L E  I N F O   ABSTRACT
ORIGINAL ARTICLE   Introduction: Listeria monocytogenes is a pathogen bacteria transmitted by food stuffs. Due to the lack of information about contamination of retail chicken meat to Listeria monocytogenes in Iran, this study aimed to determine the prevalence and antibiotic resistance of this bacterium in retail chicken meat in Yazd, Iran.
Materials and Methods: This cross-sectional descriptive study was conducted from January 2018 to June 2018 on 811 randomly selected samples from four districts located in Yazd city, Iran. Isolation of Listeria monocytogenes was performed using enrichment and selective culture media as well as biochemical tests. The positive samples were confirmed by PCR assay.
Results: In total, 247 samples (30.5%) were infected with at least one of the Listeria spp. Among the 247 samples, the isolates were 68 (27%) L. monocytogenes, 155 (63%) L. innocua, 5 (2%) L. seeligeri, 19 (8%) L. ivanovii. In current study, the antibiotic resistance of positive samples was also evaluated that especially Listeria monocytogenes were resistant to tetracycline and penicillin.
Conclusions: The presence of this pathogenic microorganism in chicken meat can be a health risk, especially for pregnant women, the elderly, and those with immune deficiency. Considering the amount of contamination with L. monocytogenes in chicken and the high mortality rate caused by it, monitoring of the health principles and standards during the production, transportation, and storage as well as training of employees in this industry are necessary.
 
Article History:
Received: 16 September 2019
Accepted: 20 November 2019
 
 
 
*Corresponding Author:
Fateme Akrami Mohajeri
Email:
Fateme.akrami@gmail.com
Tel:
+3531492274
 
 
 
Keywords:
Listeria Monocytogenes,
Chicken Meat,
PCR.
Citation: Soleimani M, Khalili Sadrabad E, Hamidian N, et al. Prevalence and Antibiotic Resistance of Listeria Monocytogenes in chicken meat retailers in Yazd, Iran. J Environ Health Sustain Dev. 2019; 4(4): 895-902.
 
Introduction
Listeria is a genus of bacteria with different strains found widely throughout the natural environment, responsible for the contamination of numerous food products. Among these, L. monocytogenes as gram-positive intracellular zoonotic pathogen present in the food industry, can cause listeriosis 1 in human. The highest mortality rate resulting by the foodborne pathogens (about 17%) has been observed in relation to this bacterial infection 2. The bacteria can exist and survive in all conditions, including low temperatures, different pH values, high concentrations of salt or bile, and oxidative stress. Regarding previous studies, some of foodborne diseases caused by contaminated meat and meat products are related to L. monocytogenes 3-4. Accordingly, one of the major problems in the food chain is due to poor management of this widely distributed bacterium which is compatible with various conditions 5.
It is obvious that use of poultry meat and its products have been accounted for many human dietary programs around the world because of high-quality nutrients such as protein, vitamins, and minerals 6. Hence, these foods are highly desirable, palatable and digestible, as well as inexpensive rather than other types of meat like beef and mutton. Moreover, the consumption of beef, sheep and poultry meat per Capita has increased nowadays7. The poultry industry is a common place that Listeria spp. can infect the chicken-meat and products.
Listeria contamination of poultry carcasses can occur in poultry slaughterhouses and processing plants during various stages, including improper cleaning and disinfecting of environment and equipment, as well as unsanitary transportation of the resulting products 8. The environment, workers, surfaces, and equipment are possible resources to infect prepared chicken products after cooking 9.
Along with the mentioned problems, globally antimicrobial and multidrug resistance among the pathogens is other serious troublemakers for human beings. The major reason for the current study is the abuse and overuse of antimicrobial agents that may result in the spread of antimicrobial-resistant pathogens, including Listeria spp., despite the effect of these agents to control the infections. Public health consequences in human population can be happened due to the spread of bacterial resistant to antimicrobial agents in contaminated food products 10.
According to our knowledge, no investigations have been conducted on Listeria spp. contamination in retail poultry meat concerning the prevalence and antibiotic susceptibility in the city of Yazd, Iran. Hence, the main purposes of the current study were to isolate and identify Listeria spp. from the chicken as well as to determine antibiotic resistance patterns of the isolates.
Material and Methods
Sample collection
This cross-sectional descriptive study was conducted from January to June 2018 on 811 randomly selected samples in Yazd city among the most popular and the busiest stores. The samples were taken separately from the stainless steel table (n = 30), poultry moving carts (n = 100), sliced carcasses (n = 170, 85 thighs and 85 chests), packed chicken (n = 100), gloves (n = 60), workers’ hands (n = 30), apron (n = 30), knife (n = 45), chicken liver (n = 100), gizzard (n = 90), refrigerator with temperature of 0-4°C (n = 56). All swab specimens were stored in Falcon tubes containing 1 ml of 0.1% peptone water, as well as the meat, liver and viscera samples (25 g) in sterile containers. All samples were transported to the laboratory in the cold box.
Isolation and identification of Listeria spp.
Guidelines proposed by the United States Department of Agriculture (USDA) were applied for isolation, so that 25 g of the sample was aseptically added to 225 ml of University of Vermont-Modified Listeria enrichment broth (UVM I enrichment medium), mixed with a stomacher device, and incubated at 37°C for 24 hours. After 24 hours, 1 ml of the initial enrichment medium was transferred to 9 ml of UVM II medium and incubated at 37°C for 24 hours, and then cultured on palcam agar medium and incubated at 25°C for 48 hours. Three suspicious colonies (black and deep) were cultured on tryptone soy agar with 0.6% yeast extract and incubated at 37°C for 24 hours 11-12. The isolated Listeria species were identified through biochemical tests, including Gram staining, catalase, mobility at 25°C and 37°C, fermentation of glucose, maltose, rhamnose, xylose and mannitol, esculin reduction, nitrate reduction, beta hemolysis, MR/VP, and CAMP test 13.
PCR assays
The isolated bacteria were cultured in Brain Heart Infusion (BHI) medium and incubated at 37°C for 18 hours 14. The extraction was performed by the boiling method, and then the DNA was extracted. The primers for Listeria genus were related to the prs gene to identify all Listeria species, including forwarding 01 (5′-GCTGAAGAGATTGCGAAAGAAG-3′) and reverse 02 (5′- CAAAGAAACCTTGGATTTGC GG-3′) to amplify 370-pb DNA fragment. The oligonucleotide primers released from hly gene for Listeria monocytogenes consisted of DG69 (5'-GTGCCGCCAAGAAAAGGTTA-3') and DG74 (5'-CGCCACACTTGAGATAT-3') to amplify 636-pb DNA fragment. The PCR mixture was used for each sample after optimization of its component concentrations, including the
primers, distilled water, Master Mix and Template DNA in 25 μl for each PCR reaction. The mixture was placed in a thermal cycle for gene amplification. Subsequently, the PCR products were electrophoresed on 1.5% agarose gel 15-16.
Antimicrobial susceptibility test
One strain of each positive Listeria sample was selected for the antibiotic susceptibility test using the disk diffusion method on Muller Hinton
agar supplemented with 5% defibrinated sheep blood in accordance with standard guidelines 17. The studied antibiotic disks were vancomycin (30 μg), trimethoprim/sulfamethoxazole (1.25/23.75 μg), clindamycin (2 μg), erythromycin (15 μg), ampicillin (10 μg), ciprofloxacin (5 μg), tetracycline (30 μg), chloramphenicol (30 μg), gentamicin (10 μg), penicillin G (10U/IE), rifampin (5 μg) and enrofloxacin (5 μg)18.
Then, each Listeria monocytogenesis strain was cultured as scratch method and the disks were placed onto each plate (5 antibiotic disks per plate) and incubated at 35°C for 24 hours. The inhibition zone diameter was measured. The findings were interpreted according to the criteria provided by the CLSI (Clinical and Laboratory Standards Institute) table. Staphylococcus aureus ATCC29213 and Escherichia coli ATCC25922 were used as quality control organisms in the determination of antibiotic susceptibility.
Statistical analysis
The data were analyzed by SPSS 18 software using descriptive statistics and Chi-square test to compare the prevalence of contamination and bacterial resistance.
Results
The results of Listeria contamination in 811 samples, including raw chicken, viscera and poultry retail equipment in Yazd are summarized in Table 1. The PCR result was used as the final confirmation of the identity of presumptive colonies isolated in this study (Figure 1). In total, 247 samples (30.5%) were infected with one of the Listeria strains. Among the 247 samples, the isolates were 68 (27%) L. monocytogenes, 155 (63%) L. innocua, 5 (2%) L. seeligeri, and 19 (8%) L. ivanovii.
 

Figure 1: A representative gel of PCR-amplified products of Listeria spp.
Lane 1: DNA ladder (50 bp); lane 2: positive control Listeria spp.; lanes 3: positive control L. monocytogenes; lanes 4: positive Listeria spp. isolates showing specific bands at 630 bp; lanes 5 positive L. monocytogenes isolates showing specific bands at 370 bp; lanes 6 negative control for Listeria spp.; lanes 7: negative control for L. monocytogenes

 
Among the strains, L. innocua had the highest incidence. Moreover, during the different stages, the most prevalence was related to the gizzard (45.5%), stainless steel (40%), and liver (40%). The maximum prevalence of L. monocytogenes was in the apron (57.2%) and chicken thigh (40%). The lowest prevalence of L. monocytogenes was for knife (9%) and workers’ hands (14.2%) (Table 1). All 68 isolates of L. monocytogenes identified within culturing methods were confirmed using PCR technique.
In current study, all Listeria isolates were tested for resistance to 12 different antibiotics by the disk diffusion method. Most isolates were resistant to tetracycline and penicillin. The bacterial resistance to various antibiotics is shown in Table 2. The results obtained from the present study indicated high resistance of L. monocytogenes and L. innocua to tetracycline and penicillin. Among all samples, 73 samples (29.5%) were resistant to one antibiotic, 76 samples (30.7%) to two antibiotics and 80 samples (32.3%) to more than two antibiotics. Among all samples, 10 (4%) and 15 (6%) samples had the minimum resistance to vancomycin and erythromycin, respectively.
Table 1: Prevalence of Listeria spp. by sample types.
L.seeligeri
No. (%)
L.ivanovii
 No. (%)
L.innocua No. (%) L.monocytogenes No. (%) Listeria spp.
No. (%)
Samples
No.
Place
0(-) 1(8) 9(75) 3(25) 12(4) 30 Stainless steel table
1(5) 0(-) 14(67) 6(28) 21(21) 100 poultry meat crates
2(7) 1(3.5) 14(49.5) 11(40) 28(32.9) 85 Raw chicken drumsticks
1(4) 0(-) 15(60) 9(36) 25(29.4) 85 Raw chicken breast
3(7.5) 2(5) 23(57.5) 12(30) 40(40) 100 packaged raw chicken
0(-) 0(-) 5(62.5) 3(37.5) 8(13.3) 60 Gloves
0(-) 0(-) 6(85.8) 1(14.2) 7(23.3) 30 Workers hands piece of chicken
1(14.3) 0(-) 2(28.5) 4(57.2) 7(23.3) 30 Aprons workers
3(27) 0(-) 6(55) 2(18) 11(24.4) 45 Knife
6(15) 2(5) 25(62.5) 7(17.5) 40(40) 100 Liver
2(5) 0(-) 30(73) 9(22) 41(45.5) 90 gizzard
0 0(-) 5(71.5) 2(28.5) 7(12.5) 56 Refrigerator  (0 - 4°C)
19(7.7) 5(2) 154 (62.4) 69(27.9) 247(30.5) 811 Total
Table 2: Antimicrobial resistance patterns of Listeria spp. isolated from poultry products.
L. seeligeri No. (%) L. ivanovii No. (%) L. innocua No. (%) L. monocytogenes No. (%) Listeria spp.
No. (%)
Antimicrobial
agent
0(-) 1(1.1) 60(65.2) 33.7(33.7) 92(10.4) Ampicillin
5(7) 3(4.1) 45(63.4) 18(25.4) 71(8.1) Chloramphenicol
2(2.8) 1(1.4) 49(68.1) 20(27.8) 72(8.2) Ciprofloxacin
2(8.7) 0(-) 19(82.6) 2(8.7) 23(2.6) Clindamycin
6(9.8) 0(-) 37(60.7) 18(29.5) 61(6.9) Enrofloxacin
0(-) 1(6.7) 12(80) 2(13.3) 15(1.7) Erythromycin
1(4) 0(-) 22(88) 2(8) 25(2.8) Gentamycin
3(2.6) 4(3.5) 67(58.8) 40(35.1) 114(12.9) Penicillin
0(-) 0(-) 11(52.4) 10(47.6) 21(2.4) Rifampin
3(2.5) 6(5.1) 73(61.9) 36(30.5) 118(13.4) Tetracycline
0(-) 0(-) 21(70) 9(30) 30(3.4) Trimethoprim/
Sulfamethoxazole
0(-) 0(-) 5(50) 5(50) 10(1.1) Vancomycin
3(4.1) 1(1.4) 48(65.8) 21(28.8) 73(8.3) Resistance to 1 antimicrobial
4(4.2) 3(3.9) 43(56.6) 26(34.2) 76(8.6) Resistance to 2 antimicrobials
3(3.8) 2(2.6) 42(52.5) 33(41.3) 80(9.1) Resistance to > 2 antimicrobials

 
Discussion
Poultry meat centers are environments with suitable temperature and humidity for the growth of Listeria bacteria. Therefore, the bacterium can remain in the environment for few months or even years, which leads to food contamination. Sustainability of Listeria in the environment is due to its ability to create a biofilm on different levels. The first comprehensive study on the prevalence of listeria in Iran was reported by Jalali and Abedi in Isfahan. In their study, from the total 617 samples achieved from different foods, 4.6% had Listeria. The infection rate in fresh poultry meat was 4.5% and all positive samples were related to Listeria innocua; none of the samples were contaminated with Listeria monocytogenes 19. Fallah et al. reported a prevalence of 34% for raw poultry meat at the supply level in center of Iran 20. The amounts of contamination in current study for Listeria monocytogenes, Listeria innocua, Listeria ivanovii, and Listeria seeligeri were 14.1%, 16.1%, 2.51%, and 2.01%, respectively. Jamali et al. also reported that the prevalence of Listeria in the chicken retail centers of Tehran was 16.1%. The infection rates related to L. ivanovii, L. monocytogenes, L. innocua, and L. seeligeri were respectively 9.8%, 3.6%, 2.1%, and 0.7%. In another study conducted in 5 large cities of Iran 21, the mean prevalence of Listeria in meat retail centers was 15.8%. In present research, the prevalence of Listeria in Yazd was 17.7%. The prevalence of L. monocytogenes, L. innocua, and L. welshimeri was reported as 2.1%, 14.6%, and 1%, respectively. The prevalence of Listeria achieved from the current study was higher than the previous studies carried out in Iran, but it was consistent with the results reported from different countries; 34% in Canada 22, 28% in Japan 23, and 32.7% in Turkey 24.
In order to compare the results of the present study with those of other studies, the country, the separation technique, and the investigated type of tissue should be considered. The actual incidence of L. monocytogenes is generally higher than the reported results through the traditional isolation method, which relies on selective enrichment medium (UVM) and Fraser broth to purify L. monocytogenes. At temperatures below 40 ° C, L. innocua grows faster than L. monocytogenes and this is one of the reasons for higher prevalence of L. innocua than L. monocytogenes which was reported in the current study because the conventional enrichment method is more in favor of L. innocua spp. growth. In previous studies, L. innocua was more prevalent than the other species 20-21, 25-27. The prevalence of L. monocytogenes in the northern European countries was 22% 28, in Italy 21.8% 26, and in Sri Lanka was 34% 29 that is compatible with the current results.
In Loura et al. research, the chicken liver samples were investigated and 10% and 20% of infections were reported by L. innocua and L. grayi, respectively. None of the samples were contaminated with L. monocytogenes 30. A study conducted in Bulgaria showed that from 112 samples of goose liver, 35.7% were contaminated with L. monocytogenes 31. The prevalence of L. monocytogenes in the chicken liver in Iran was 21.6 20, in Brazil 23.3% 32, in Malaysia 25% 33, which was consistent with the results achieved form the current study. Chicken's liver and gizzard are not contaminated during slaughter; their most important source of contamination is after slaughter and in processing by cross-contamination between other parts of the poultry and table, equipment, and the work environment 33-34.
Laura et al. found that the knife used to cut chicken was 80% and 50% contaminated with L. monocytogenes and L. innocua, respectively, while no contamination with L. monocytogenes was observed in workers' gloves 30. Barbalho et al. 35 reported that contamination of workers' hands and gloves by L. monocytogenes and L. innocua, were 11.8% and 40.5%, respectively which are consistent with the current study. Kerr 36 and Yuewei 37 found 11.8% of contamination with L. monocytogenes in workers' hands and gloves that were in line with the current results. High contamination in equipment shows that conventional disinfection methods are inefficient 30.
Studies represent that the antibiotic resistance of L. monocytogenes isolated from foods is increasing worldwide 38. In a study on chicken meat offered in Ankara, Turkey27, L. monocytogenes, L. welshimeri, and L. innocua species were very sensitive to chloramphenicol (88-100%), but they showed resistance to ampicillin (66-100%). In present study, the bacteria were most resistance to tetracycline and penicillin, while the least rate of resistance was to vencomycin and erythromycin. Antibiotic resistance results in present study showed high resistance of L. monocytogenes to ampicillin, tetracycline, chloramphenicol, and penicillin antibiotics. Antibiotic resistance of Listeria sp. is due to the acquisition of genetic elements such as moving plasmids and conjugate transposons 39.
Osaili et al. 25, in Jordan, observed that from 10 antibiotic tests of chicken meat samples, the highest resistance was related to tetracycline. Furthermore, Fallah et al. 20, studied poultry products in the central part of Iran and reported that the highest antibiotic resistance was for ampicillin, penicillin, and tetracycline that are consistent with the results of the present study. Walsh et al. 40, showed that the highest antibiotic resistance of L. monocytogenes is related to tetracycline and penicillin antibiotics with 6.7% and 3.7% of prevalence, respectively. The antibiotic resistance of L. innocua in current study was more than that of L. monocytogenes. Although the genetic basis for these differences is not known, the presence of plasmids encoded antibiotic resistance was reported in L. innocua 40. In the current study, L. innocua had the highest resistance to antibiotics spectrum, which is consistent with the above study. There are different factors causing the antibiotic resistance of various bacteria, such as excessive consumption of antibiotics in the poultry industry. The conducted studies in the field of antibiotic resistance of Listeria bacteria have indicated that this bacterium has a growing resistance to different antibiotics, which can increase the risk of infection for children, pregnant women, the elderly, and those with immune deficiency 41.
 
 
Conclusion
The results of present study provide information about the contamination state of raw poultry meat and retailers’ equipment in Yazd, Iran. The presence of this pathogenic microorganism in chicken meat can be a health risk, especially for pregnant women, the elderly, and those with immune deficiency. Considering the amount of contamination with L. monocytogenes in chicken and the high mortality rate caused by it, monitoring of the health principles and standards during the production, transportation, and storage as well as training of employees in this industry are necessary.
Acknowledgments
The authors acknowledge the cooperation and assistance of the laboratory department of Food Hygiene and Safety, School of Public Health, Shahid Sadoughi University of Medical Sciences, Yazd, Iran.
Funding
This work was supported by the School of Public Health, Shahid Sadoughi University of Medical Sciences, Yazd, Iran.
Conflict of interests
All authors declare that they have no competing interests.
 
This is an Open Access article distributed in accordance with the terms of the Creative Commons Attribution (CC BY 4.0) license, which permits others to distribute remndix, adapt and build upon this work for commercial use.
 
References
  1. Camargo AC, Woodward JJ, Nero LA. The continuous challenge of characterizing the foodborne pathogen Listeria monocytogenes. Foodborne Pathog Dis. 2016;13(8):405-16.
  2. Carpentier B, Cerf O. Persistence of Listeria monocytogenes in food industry equipment and premises. Int J Food Microbiol. 2011;145(1):1-8.
  3. Dutilly DK. Response of Listeria monocytogenes to high hydrostatic pressure or freeze-thaw cycles following exposure to selected environmental stresses: Iowa State University; 2011.
  4. Hamidiyan N, Salehi-Abargouei A, Rezaei Z, et al. The prevalence of Listeria spp. food contamination in Iran: A systematic review and meta-analysis. Food Res Int. 2018;107:437-50.
  5. Silva DA, Camargo AC, Todorov SD, et al. Listeria spp. contamination in a butcher shop environment and Listeria monocytogenes adhesion ability and sensitivity to food‐contact surface sanitizers. J Food Saf. 2017;37(2): e12313.
  6. Hussain P, Somoro AH, Hussain A, et al. Evaluation of quality and safety parameters of poultry meat products sold in hyderabad market, Pakistan. World J Agric Res. 2016;4(3):85-93.
  7. Assis K, Komilus C, Bonaventure B, et al. Consumption patterns of chicken, beef and mutton: A study among consumers in Kota Kinabalu, Sabah, Malaysia. J Biomed Phys Eng. 2015;2:279-86.
  8. Mead GC. Food safety control in the poultry industry: CRC Press; 2005.
  9. Moura GF, de Oliveira Sigarini C, de Souza Figueiredo EE. Listeria monocytogenes in chicken meat. J Food Nutr Res. 2016;4(7):436-41.
  10. Filiousis G, Johansson A, Frey J, et al. Prevalence, genetic diversity and antimicrobial susceptibility of Listeria monocytogenes isolated from open-air food markets in Greece. Food control. 2009;20(3):314-7.
  11. McClain D, Lee W. Development of USDA-FSIS method for isolation of Listeria monocytogenes from raw meat and poultry. J Assoc Off Anal Chem. 1988;71(3):660-4.
  12. Akrami-Mohajeri F, Derakhshan Z, Ferrante M, et al. The prevalence and antimicrobial resistance of Listeria spp in raw milk and traditional dairy products delivered in Yazd, central Iran. Food Chem Toxicol. 2018;114:141-4.
  13. Roberts D, Hooper W, Greenwood M. Isolation and enrichment of microorganisms. Practical food microbiology, 3rd ed. Blackwell Publishing Ltd, Malden, MA. 2003.
  14. Güssow D, Clackson T. Direct clone characterization from plaques and colonies by the polymerase chain reaction. Nucleic Acids Res. 1989;17(10):4000.
  15. Doumith M, Buchrieser C, Glaser P, et al. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J Clin Microbiol. 2004;42(8): 3819-22.
  16. Choi WS, Hong CH. Rapid enumeration of Listeria monocytogenes in milk using competitive PCR. Int J Food Microbiol. 2003; 84(1):79-85.
  17. Wikler MA. Performance standards for antimicrobial susceptibility testing, sixteenth informational supplement, M100-S16. Pennsylvania Clinical and Laboratory Standards Institute (CLSI). 2006.
  18. Performance standards for antimicrobial disk susceptibility tests (9th ed.), 2006.
  19. Jalali M, Abedi D. Prevalence of Listeria species in food products in Isfahan, Iran. Int J Food Microbiol. 2008;122(3):336-40.
  20. Fallah AA, Saei-Dehkordi SS, Rahnama M, et al. Prevalence and antimicrobial resistance patterns of Listeria species isolated from poultry products marketed in Iran. Food control. 2012;28(2):327-32.
  21. Jamali H, Radmehr B, Meloni D. Prevalence of Listeria monocytogenes in poultry marketed in Iran: Characterization and Antimicrobial Resistance of the Isolates. Listeria monocytogenes: Incidence, growth behavior and control. 2015;43:105-16.
  22. Bohaychuk V, Gensler G, King R, et al. Occurrence of pathogens in raw and ready-to-eat meat and poultry products collected from the retail marketplace in Edmonton, Alberta, Canada. J Food Prot. 2006;69(9):2176-82.
  23. Ochiai Y, Yamada F, Batmunkh O, et al. Prevalence of Listeria monocytogenes in retailed meat in the Tokyo metropolitan area. J Food Prot. 2010;73(9):1688-93.
  24. Ceylan Z, Demirkaya A, Adigüzel G. Incidence of Listeria monocytogenes in retail chicken meat and establishing relationship with some bacteria by logistic regression. J Food Qual. 2008;31(1):121-30.
  25. Osaili TM, Alaboudi AR, Nesiar EA. Prevalence of Listeria spp. and antibiotic susceptibility of Listeria monocytogenes isolated from raw chicken and ready-to-eat chicken products in Jordan. Food control. 2011;22(3):586-90.
  26. Pesavento G, Ducci B, Nieri D, et al. Prevalence and antibiotic susceptibility of Listeria spp. isolated from raw meat and retail foods. Food control. 2010;21(5):708-13.
  27. Yücel N, Cıtak S, Önder M. Prevalence and antibiotic resistance of Listeria species in meat products in Ankara, Turkey. Food Microbiol. 2005;22(2):241-5.
  28. Gudbjörnsdóttir B, Suihko M-L, Gustavsson P, et al. The incidence of Listeria monocytogenes in meat, poultry and seafood plants in the Nordic countries. Food Microbiol. 2004;21(2):217-25.
  29. Gunasena D, Kodikara C, Ganepola K, et al. Occurrance of Listeria monocytogenes in food in Sri Lanka. J Natl Sci Found. 2013;23(3): 175-8.
  30. Loura CA, Almeida RC, Almeida PF. The incidence and level of Listeria spp. and Listeria monocytogenes contamination in processed poultry at a poultry processing plant. J Food Saf. 2005;25(1):19-29.
  31. Karakolev R. Incidence of Listeria monocytogenes in beef, pork, raw-dried and raw-smoked sausages in Bulgaria. Food control. 2009; 20(10):953-5.
  32. Reiter MG, Bueno CM, Lopez C, et al. Occurrence of Campylobacter and Listeria monocytogenes in a poultry processing plant. J Food Prot. 2005;68(9):1903-6.
  33. Kuan CH, Goh SG, Loo YY, et al. Prevalence and quantification of Listeria monocytogenes in chicken offal at the retail level in Malaysia. Poult Sci. 2013;92(6):1664-9.
  34. Arumugaswamy RK, Ali GRR, Hamid SNBA. Prevalence of Listeria monoctogenes in foods in Malaysia. Int J Food Microbiol. 1994;23(1):117-21.
  35. Barbalho TC, Almeida PF, Almeida RC, et al. Prevalence of Listeria spp. at a poultry processing plant in Brazil and a phage test for rapid confirmation of suspect colonies. Food control. 2005;16(3):211-6.
  36. Kerr K, Birkenhead D, Seale K, et al. Prevalence of Listeria spp. on the hands of food workers. J Food Prot. 1993;56(6):525-7.
  37. Hu Y, Gall K, Ho A, et al. Daily variability of Listeria contamination patterns in a cold-smoked salmon processing operation. J Food Prot. 2006;69(9):2123-33.
  38. Lungu B, O'Bryan CA, Muthaiyan A, et al. Listeria monocytogenes: antibiotic resistance in food production. Foodborne Pathog Dis. 2011;8(5):569-78.
  39. Charpentier E, Gerbaud G, Jacquet C, et al. Incidence of antibiotic resistance in Listeria species. Journal of Infectious Diseases. 1995; 172(1): 277-81.
  40. Walsh D, Duffy G, Sheridan JJ, et al. Antibiotic resistance among Listeria, including Listeria monocytogenes, in retail foods. J Appl Microbiol. 2001; 90(4):517-22.
  41. Alonso-Hernando A, Prieto M, García-Fernández C, et al. Increase over time in the prevalence of multiple antibiotic resistance among isolates of Listeria monocytogenes from poultry in Spain. Food control. 2012;23(1):37-41.

 
Type of Study: Original articles |
Received: 2019/09/16 | Accepted: 2019/11/20 | Published: 2019/12/21

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2015 All Rights Reserved | Journal of Environmental Health and Sustainable Development

Designed & Developed by : Yektaweb